BACE - DNA combination and Ship

Some samples still have poor yields, so combine samples and reconcentrate

Followed protocol for Amicon Pro Purification System:

 MCBA15 004 - combine 4.1 and 4.2 from 2/25

 MCBA15 007 - combine from both extraction days

 MCBA15 015 - combine from both extraction days

 MCBA15 017 - combine from both extraction days

 MCBA15 019 - combine 19.1 and 19.2 from 2/25

 MMLR15 020 - combine from both extraction days

Quantified with Qubit on BioTek at 485/530 nM

Sample ID     Concentration (ng/uL)   Volume (uL)

MCBA15 004           20.8                 95

MCBA15 007            7.7                 90

MCBA15 015           34.9                100

MCBA15 017*          81.0                100 

MCBA15 019           11.0                 90

MMLR15 020            4.9                 95

 *split in two  

Shipped out sample on 3/3/15 (due to weather):

Sample ID        Total DNA (ng)

MCBA15 004          1976.0

MCBA15 007           693.0

MMLR15 010*          672.0

MMLR15 011*          616.0

MCBA15 015          3490.0

MCBA15 017          3645.0

MCBA15 019           990.0

Samples delivered and received 3/4/15 - email from Michael

_____________________________________

Samples not sent out due to poor yields:

MMLR15 018 - slow growing

MCBA15 021 - Frigoribacterium; did not redo

MMLR15 022 - Frigoribacterium; did not redo

BACE - DNA Extraction Pt II

Try and extract DNA from samples that I could not get enough DNA from on 2/17

   ***for samples with really poor yields from last time, extracted two sets

Need more Lysozyme - 10 mg/mL in 60 uL x 20 samples

   TEN Buffer: 

      40 mM Tris-HCl ph=7.5

      1 mM EDTA ph=8.0

      150 mM NaCl

      Stock Solutions:      

      400 mM Tris-HCl = 6.30 g in 100 mL dH2O

      100 mM EDTA = 2.92 g in 100 mL dH2O

      300 mM NaCl = 1.75 g in 100 mL dH2O

      --> 1500 uL TEN Buffer = 750 uL NaCl + 15 uL EDTA + 150 uL Tris-HCl + 585 uL ddH2O

   Add 1 mL TEN Buffer + 10 mg Lysozyme = 10 mg/mL

Followed Promega Wizard DNA Purification Kit Protocol for gram-positive bacteria

   EXCEPT:

      Added 2 mL of liquid grown culture

      Added 10 mg/mL of 60 uL + 60 uL ddH2O = 120 uL

      Added 60 uL of Rehydration Solution

Quantified with Qubit kit on BioTek at 485/530 nM

Sample ID     Concentration (ng/uL)

MCBA15 004.1      7.9

MCBA15 004.2     20.8

MCBA15 007        4.9

MMLR15 010        0.0 - probably lost pellet 

MCBA15 015       10.7

MCBA15 017.1      8.7

MCBA15 017.2      0.3

MMLR15 018.1      1.0 - grows slow, not much input

MMLR15 018.2      3.1 - grows slow, not much input

MCBA15 019.1      7.5

MCBA15 019.2     13.5

MMLR15 020       16.6

BACE - DNA Extractions and Shipment

Shipped out samples to MIT - Martin Polz and Michael Cutler

Curtobacterium samples (n=11) sent on 2/17/15:

Sample ID      Total DNA (ng)
MCBA15 001         981.0
MMLR15 002        1254.2
MCBA15 003         893.8
MCBA15 005         953.9
MMLR15 006         943.6
MCBA15 008        1657.8
MCBA15 009         922.6
MCBA15 012         962.3
MCBA15 013        1240.4
MMLR15 014        1153.8
MCBA15 016         756.7

Samples Received on 2/19/15

BACE - DNA Extraction

Followed Promega DNA Extraction Kit Protocol

Results were better than Spin Column method, but still not great for some samples.

EMP - Align OTUs

Took the rep set of sequences and pulled out Curtobacterium OTUs only (Curtobacterium were assigned by GreenGenes database)

Aligned curto only sequences with SINA

Sequences are really short (~150 bp) - see how they incorporate into sequenced data from BACE litter (align with all sequences that were a hit for Microbacteriaceae)

BACE, Curto - Phylogeny

Used ARB-Silva SINA to align sequences and ARB to generate phylogeny

***May take out sequences (see below post; specifically AB_3.17L, AB_3.19L, AB_3.27L) that do not have full 16S gene - do not fit great into phylogeny

EDIT: new phylogeny with scale generated by ARB tree generator 

BACE, Curto - Sequence Data

Received sequence data from Beckman Genomics Institute

Trimmed sequences:
   Eliminated below 5% probability and trimmed first 20 bp (length of primers)

Primers used:
Forward Primer 

AGAGTTTGATCCTGGCTCAG

Reverse Primer

AAGGAGGTGATCCAGCCGCA

Assembled de novo:

   Samples with No contig overlap - could not assemble (n = 12) - used either F or R strand for id

      AB 3.02L - gel shows blurry line at 1500 bp

      AB 3.04L - multiple bands 

      AB 3.05L - bright band at 1500 bp

      AB 3.12L - bright, smeared band at 1500 bp

      AB 3.17L - multiple bands ~1500 bp

      AB 3.19L - very faint band at 1500 bp

      AB 3.27L - no visible band

      AB 3.37L - bright, smeared band at 1500 bp

      *AB 3.04B - multiple bands

      *AB 3.09B - multiple bands

      AB 3.13B - bright band at 1500 bp

      *Curto 145 (redo) - no visible band

      *low quality read percentage - did not include 

Blast samples - blast against nr/nt database

BACE, Curto - PCR

Performed PCR:

	1 Rxn (μl)	Rxn Number	Total
		96
dH2O	11.3		1084.8
Premix F	15		1440.0
pA (50μM)	0.2		19.2
pH' (50μM)	0.2		19.2
Taq (5units/μl)	0.3		28.8
DNA	3.0

rDNA 16S Gene for 1500 bp 

Primers Used:

Forward Primer - pA -> 27f / E8F

Reverse Primer - pH' -> 1525f / E1541F

ThermoCycler:
95 for 4:00 min
*95 for 0:40 min
*55.5 for 0:30 min
*72 for 2 min
72 for 3:30 min
Hold at 4
*Repeat for 30 cycles

LOOKED REALLY GOOD!

Transfer 20 uL to new plate - READY FOR SEQ

Claudia sent out to Beckman Genomics Institute on 1/13/15

BACE - Isolate Strains

12/8/2014
Got done streaking the cultures grown on BACE media (n=39). Took no cultures from 1:10000 dilutions

12/9/2014
Got done streaking the cultures grown on Loma Ridge media (n=40). Took no cultures from 1:10000 dilutions

BACE - Culture litter

1. Took Boston litter and ran through autoclaved sieves (2000 um -> 250 um -> 25 um)
1. ***NEXT TIME - GRIND UP LITTER BEFOREHAND
2. Scraped water and residue in bottom two filters into 50mL conicals
3. Add litter residue to vacuum filter (no vacuum attached) with 100 um filter
4. Rinse conicals 2x with autoclaved DI H2O
5. Total of 200 mL of litter residue and add to new set of 50mL conicals
6. Dilute each tube to 1x, 1:100, 1:1000, 1:10000
7. Plate 100 uL of each dilution on media plates:
1. For this experiment, plated on both Loma Ridge Media and BACE Media

BACE - Leaf Litter

Jen contacted Jeff Dukes at Purdue to get leaf litter from their grassland site in Boston.

Hopefully, this will be shipped next week (11/17).
***Claudia sent them a box on 11/13/14***

Need to find the leaf litter media from lab intranet (Kristen could help).

Found the following:

-       Grind litter for 30 seconds to break into smaller chunks. Continue until you have ~200ml of ground litter.

-       Add litter and 1 liter of DI water to large flask. Cover top with foil.

-       Place on stir plate for 24 hours.

-       Allow litter to settle for 24-48 hours.

-       Decant liquid (siphon or scoop) into clean flask (you should have ~800 ml of media).

-       Filter media through 100 μm, 8 μm, 3 μm, and 0.8 μm membranes (I use larger sizes first to decrease the use of expensive 0.8 μm filters).

-       Transfer media into autoclavable jug. Add 15g agar and fill with DI water until final volume reached 1 litter.

-       Autoclave (Liquid cycle)