BACE, Curto - Phylogeny

Used ARB-Silva SINA to align sequences and ARB to generate phylogeny

***May take out sequences (see below post; specifically AB_3.17L, AB_3.19L, AB_3.27L) that do not have full 16S gene - do not fit great into phylogeny

EDIT: new phylogeny with scale generated by ARB tree generator 

BACE, Curto - Sequence Data

Received sequence data from Beckman Genomics Institute

Trimmed sequences:
   Eliminated below 5% probability and trimmed first 20 bp (length of primers)

Primers used:
Forward Primer 

AGAGTTTGATCCTGGCTCAG

Reverse Primer

AAGGAGGTGATCCAGCCGCA

Assembled de novo:

   Samples with No contig overlap - could not assemble (n = 12) - used either F or R strand for id

      AB 3.02L - gel shows blurry line at 1500 bp

      AB 3.04L - multiple bands 

      AB 3.05L - bright band at 1500 bp

      AB 3.12L - bright, smeared band at 1500 bp

      AB 3.17L - multiple bands ~1500 bp

      AB 3.19L - very faint band at 1500 bp

      AB 3.27L - no visible band

      AB 3.37L - bright, smeared band at 1500 bp

      *AB 3.04B - multiple bands

      *AB 3.09B - multiple bands

      AB 3.13B - bright band at 1500 bp

      *Curto 145 (redo) - no visible band

      *low quality read percentage - did not include 

Blast samples - blast against nr/nt database

BACE, Curto - PCR

Performed PCR:

	1 Rxn (μl)	Rxn Number	Total
		96
dH2O	11.3		1084.8
Premix F	15		1440.0
pA (50μM)	0.2		19.2
pH' (50μM)	0.2		19.2
Taq (5units/μl)	0.3		28.8
DNA	3.0

rDNA 16S Gene for 1500 bp 

Primers Used:

Forward Primer - pA -> 27f / E8F

Reverse Primer - pH' -> 1525f / E1541F

ThermoCycler:
95 for 4:00 min
*95 for 0:40 min
*55.5 for 0:30 min
*72 for 2 min
72 for 3:30 min
Hold at 4
*Repeat for 30 cycles

LOOKED REALLY GOOD!

Transfer 20 uL to new plate - READY FOR SEQ

Claudia sent out to Beckman Genomics Institute on 1/13/15

Curto - PCR

Took Kristen's Curtobacterium strains from deep freeze and plated.

Performed PCR:

	1 Rxn (μl)	Rxn Number	Total
		12
dH2O	13.3		159.6
Premix F	15		180
pA (50μM)	0.2		2.4
pH' (50μM)	0.2		2.4
Taq (5units/μl)	0.3		3.6
DNA	1

rDNA 16S Gene for 1500 bp 

Primers Used:

Forward Primer - pA -> 27f / E8F

Reverse Primer - pH' -> 1525f / E1541F

5 of the 9 strains amplified

Need to reevaluate strains that failed

Curto - Kristen's Isolates

Need to find Kristen's Curtobacterium isolates. Jen sent spreadsheet with isolates that have been deep frozen "~/Documents/Research/m.curtobacterium/bacterial-strains/bacterial-cultures.xlsx"

From Lab Intranet, strains to consider (n=9):

109
115
136
145
163
171
183*
190*
213**

*originally classified as Okibacterium in Kristen's spreadsheet
**not listed in spreadsheet

Kristen says the spreadsheet in outdated but Intranet should be correct.

Streaked strains on to new LB plates and, eventually, sequence 16S to verify that they are Curtobacterium