Trimmed sequences:
Eliminated below 5% probability and trimmed first 20 bp (length of primers)
Primers used:
Forward Primer
| AGAGTTTGATCCTGGCTCAG |
| AAGGAGGTGATCCAGCCGCA |
Assembled de novo:
Samples with No contig overlap - could not assemble (n = 12) - used either F or R strand for id
AB 3.02L - gel shows blurry line at 1500 bp
AB 3.04L - multiple bands
AB 3.05L - bright band at 1500 bp
AB 3.12L - bright, smeared band at 1500 bp
AB 3.17L - multiple bands ~1500 bp
AB 3.19L - very faint band at 1500 bp
AB 3.27L - no visible band
AB 3.37L - bright, smeared band at 1500 bp
*AB 3.04B - multiple bands
*AB 3.09B - multiple bands
AB 3.13B - bright band at 1500 bp
*Curto 145 (redo) - no visible band
*low quality read percentage - did not include
Blast samples - blast against nr/nt database

No comments:
Post a Comment