BACE, Curto - Sequence Data

Received sequence data from Beckman Genomics Institute

Trimmed sequences:
   Eliminated below 5% probability and trimmed first 20 bp (length of primers)

Primers used:
Forward Primer 

AGAGTTTGATCCTGGCTCAG

Reverse Primer

AAGGAGGTGATCCAGCCGCA

Assembled de novo:

   Samples with No contig overlap - could not assemble (n = 12) - used either F or R strand for id

      AB 3.02L - gel shows blurry line at 1500 bp

      AB 3.04L - multiple bands 

      AB 3.05L - bright band at 1500 bp

      AB 3.12L - bright, smeared band at 1500 bp

      AB 3.17L - multiple bands ~1500 bp

      AB 3.19L - very faint band at 1500 bp

      AB 3.27L - no visible band

      AB 3.37L - bright, smeared band at 1500 bp

      *AB 3.04B - multiple bands

      *AB 3.09B - multiple bands

      AB 3.13B - bright band at 1500 bp

      *Curto 145 (redo) - no visible band

      *low quality read percentage - did not include 

Blast samples - blast against nr/nt database